First Ever Video of Silkhenge Spider Birth

Press Pass Collectibles

Silkhenge, Mystery Web Tower, White-Picket Fence Structure- whatever the name, it is a spider egg surrounded by mystery. What species is it? What is the function? How is it made?

For any licensing requests please contact licensing@break.com

Another expedition, another clue. This time, video of the birth and a DNA barcode sequence. The sequence is open access, below:

Web tower-COI-5P
GACTTTATATTTGTTATTTGGAGTATGGGCTGCTATAGTTGGGACTGCAATAAGAGTATTAATTCGAGTTGAGTTAGGGCAACCAGGAAGATTATTAGGGGATGATCAACTATATAATGTAATTGTTACTGCTCATGCTTTTATTATAATTTTTTTTATAGTAATGCCAATTTTAATTGGGGGATTTGGAAATTGATTAATTCCTATAATGTTAGGAGTACCTGATATAGCTTTTCCTCGGATAAATAATCTTAGTTTTTGATTATTACCCCCTTCTTTGTTTTTACTTTTAATTTCTTCTTTAAATGAAATAGGAGTTGGGGCTGGGTGAACAGTATACCCTCCTTTATCTTCTTTGGAAGGTCATAATAATAGATCTATAGATTTTGCTATTTTTTCTTTACATTTAGCTGGGGCATCTTCAATTATGGGAGCAATTAATTTTATTACTACAATTATAAATATACGGAGAGTAGAATTTAAAATAGAAAATATTTCTTTATTTATTTGATCTGTTTTAATTACAGCAGTACTTTTATTATTGTCTTTACCTGTATTAGCAGGTGCTATTACTATATTATTAACAGATCGTAATTTTAATACATCTTTTTTTGATCCTTCTGGAGGAGGGGACCCTGTTTTATTTCAACATTTATTT

Link to the BLAST website where we aligned the piece of DNA

We found a total of 5 silkhenge structures and watched three spiders hatch from this. Filmed on an olloclip and Canon 70D.

Subscribe to Aaron’s channel on YouTube:

Visit Yasuni Naitonal Park at

Special thanks to Tropical Herping for guiding us through to Yasuni. Want to visit there? Check them out: /

Stan Lee Signed Amazing Spider-Man #107 Comic Book

See also  Itsy Bitsy Spider (Halloween Ver.) 🎃|2021 Halloween Songs|Spooky Nursery Rhymes 👻|Dragon Dee Kids